MUTATIONS APOE 45411924 GRCh37/hg19 rs937063425 C T Exon 4 Coding No effect on receptor binding, internalization, or degradation. A124V Alzheimer's Disease, Blood Lipids/Lipoproteins, Cardiovascular Disease This rare variant was found in a randomly selected co
MUTATIONS APOE 45412079 GRCh37/hg19 C T 45411941 GRCh37/hg19 T C Exon 4 Coding Unknown. [C130R;R176C] Blood Lipids/Lipoproteins, Motor Neuron Disease This rare genotype is a combination of an arginine at position 130 and a cysteine at position 176 on the same chrom
MUTATIONS APOE 45411948 GRCh37/hg19 G C Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 25). R132P Cardiovascular Disease, Diabetes Mellitus This variant was identified in a U.K. study of 765 individuals with type 2 diabetes (Stephen
MUTATIONS APOE 45411947 GRCh37/hg19 rs11542041 C T Exon 4 Coding Enhanced aggregation, destabilized protein. R132C Splenomegaly This variant was found in an 18-year-old Japanese woman with lipoprotein glomerulopathy (LPG), a rare kidney disorder in which the glomer
MUTATIONS APOE 45411947 GRCh37/hg19 rs11542041 C A Exon 4 Coding Unknown, but predicted deleterious in silico by multiple algorithms. R132S This variant has not been associated with any disease or condition, but computer modeling suggests it alters ApoE structure a
MUTATIONS APOE 45411987 GRCh37/hg19 rs267606664 G A Exon 4 Coding Decreased heparin binding and altered b-VLDL binding (LRP receptor), with no apparent effect on LDL binding. G145D Alzheimer's Disease, Multiple Conditions This variant was examined in a study o
MUTATIONS APOE 45411989 GRCh37/hg19- GAGGTGCAGGCCATGCTCGGC Exon 4 Coding Reduced receptor binding, heparin binding, HSPG-LPL binding, and lipolysis; increased preference for VLDL. G145InsEVQAMLG Hyperlipoproteinemia Type III This mutation, a tandem duplication of 2
MUTATIONS APOE 45412008 GRCh37/hg19 rs28931578 G A Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 23). R152Q This variant was identified in five Dutch individuals (de Knijff et al., 1994, unpublished findings). Two probands carrying
MUTATIONS APOE 45412013 GRCh37/hg19 rs121918393 C A Exon 4 Coding Reduced receptor and heparin binding; reduced amyloid-b aggregation. R154S Alzheimer's Disease, Multiple Conditions This variant gained attention in the Alzheimer’s disease (AD) field when it wa
MUTATIONS APOE 45412013 GRCh37/hg19 rs121918393 C T Exon 4 Coding Reduced receptor binding. R154C Alzheimer's Disease, Multiple Conditions This variant was examined in a study of dementia, including Alzheimer’s disease (AD), and was proposed as being possibly
MUTATIONS APOE 45412013 GRCh37/hg19 C- Exon 4 Coding Absence of mutant ApoE, at least in VLDL lipoprotein. R154Afs Hyperlipoproteinemia Type III This variant, predicted to eliminate ApoE expression or generate a truncated species, was identified in heterozygous for
MUTATIONS APOE 45412014 GRCh37/hg19 G A Exon 4 Coding Moderately reduced receptor and heparin binding. R154H Hyperlipoproteinemia Type III This variant has been reported in several individuals with abnormal blood lipid profiles. It was first identified in a Canadia
MUTATIONS APOE 45412037_45412045 GRCh37/hg19 CTGCGTAAG- Exon 4 Coding Unknown, but expected to alter receptor binding and heparin binding. L162_K164del Blood Lipids/Lipoproteins, Kidney Disorder: Lipoprotein Glomerulopathy This mutation results in the loss of three
MUTATIONS APOE 45412030_45412044 GRCh37/hg19 GCGCAAGCTGCGTAA- Exon 4 Coding Unknown, but expected to alter receptor binding and heparin binding. K161_R165del Blood Lipids/Lipoproteins, Kidney Disorder: Lipoprotein Glomerulopathy This variant was identified in a Chi
MUTATIONS APOE 45412031 GRCh37/hg19 C A Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 26). R160S Hyperlipoproteinemia Type IIa, Hyperlipoproteinemia Type III This variant was identified in a Japanese man diagnosed with both severe