300519 RESULTS
MUTATIONS APOE 45412031 GRCh37/hg19 rs387906567 C T Exon 4 Coding Reduced receptor binding and especially heparin binding. Increased prevalence in VLDLs. Multiple effects on lipid and lipoprotein profiles in mice. R160C Blood Lipids/Lipoproteins, Hyperlipoproteinem
MUTATIONS APOE 45412032 GRCh37/hg19 G T Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 28). R160L Cardiovascular Disease, Hyperlipoproteinemia Type III This variant was identified in a Caucasian French man and his father, both diagn
MUTATIONS APOE 45412033 GRCh37/hg19- GTGCGCCTCGCCTCCCACCTGCGC Exon 4 Coding Unknown, but alters the receptor binding and main heparin binding regions. R160InsVRLASHLR Blood Lipids/Lipoproteins, Hyperlipoproteinemia Type IV This variant, resulting in the predicted d
MUTATIONS APOE 45412041 GRCh37/hg19 rs121918397 G A Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 23). R163H Blood Lipids/Lipoproteins This variant, sequenced only at the protein level, was identified in a 29-year-old Japanese man
MUTATIONS APOE 45412040 GRCh37/hg19 rs769455 C T Exon 4 Coding Reduced heparin binding and moderately reduced receptor binding. R163C Alzheimer's Disease, Multiple Conditions This variant was examined for its potential association with late-onset Alzheimer’s d
MUTATIONS APOE 45412041 GRCh37/hg19 rs121918397 G C Exon 4 Coding Reduced receptor and heparin binding in vitro. In mice, caused LPG-like renal aggregates, altered lipid/lipoprotein profile in blood, and altered macrophage function. R163P Kidney Disorder: Lipoprote
MUTATIONS APOE 45412043 GRCh37/hg19 rs121918394 A C Exon 4 Coding Altered receptor and heparin binding; reduced VLDL lipolysis. K164Q Blood Lipids/Lipoproteins, Hyperlipoproteinemia Type III This mutation results in hyperlipoproteinemia type III (HLPP3), also known
MUTATIONS APOE 45412043 GRCh37/hg19 rs121918394 A G Exon 4 Coding Reduced receptor and heparin binding, and reduced ApoE turnover. May interfere with the coordination between lipid association and receptor binding. K164E Blood Lipids/Lipoproteins, Cardiovascular Di
MUTATIONS APOE 45412045 GRCh37/hg19 G C 45412046 GRCh37/hg19 C T Exon 4 Coding In mice, drastically altered lipid and lipoprotein profiles in blood. May act as dominant-negative receptor ligand and interfere with LPL and LCAT activities. K164_R165delinsNW Hyperlipo
MUTATIONS APOE 45412047 GRCh37/hg19 G C Exon 4 Coding Unknown, but showed enhanced binding to glomerular capillaries. Also, induced structural changes resulting in reduced ApoE stability. Predicted to disrupt oligomerization, enhance aggregation, and alter receptor
MUTATIONS APOE 45412052_45412054 GRCh37/hg19 CTC Exon 4 Coding Altered receptor binding, possibly increasing binding affinity. Also altered lipoprotein catabolism, and possibly lipolytic activity. L167del Multiple Conditions This mutation is an in-frame deletion re
MUTATIONS APOE 45412056 GRCh37/hg19 rs376170967 G A Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 23). R168H Blood Lipids/Lipoproteins, Diabetes Mellitus This variant was identified in a U.K. study of 765 individuals with type 2 di
MUTATIONS APOE 45412055 GRCh37/hg19 C T Exon 4 Coding Unknown, but may induce dimer formation and facilitate entrapment in kidney capillaries. Also, may affect receptor binding. R168C Blood Lipids/Lipoproteins, Kidney Disorder: Lipoprotein Glomerulopathy, Splenomeg
MUTATIONS APOE 45412055 GRCh37/hg19 C G Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 23). R168G Blood Lipids/Lipoproteins, Kidney Disorder: Lipoprotein Glomerulopathy This variant was identified in a 20-year-old Japanese woman dia
MUTATIONS APOE 45412056 GRCh37/hg19 G C Exon 4 Coding Unknown, but predicted deleterious in silico (PHRED-scaled CADD = 23). R168P Blood Lipids/Lipoproteins, Kidney Disorder: Lipoprotein Glomerulopathy This mutation was identified in a Chinese family spanning three
No filters selected
